View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14873_low_4 (Length: 244)
Name: NF14873_low_4
Description: NF14873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14873_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 51 - 149
Target Start/End: Original strand, 24360164 - 24360262
Alignment:
| Q |
51 |
gttgtggggtttgcttacaaattagggaagagtagtgagagagaaacagaaagaggagttggttggttgatgagtctagttgaaaaagaaaacggtttg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24360164 |
gttgtggggtttgcttacaaattagggaagagtagtgagagagaaacagaaagaggagttggttggttgatgagtctagttgaaaaagaaaacggtttg |
24360262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 183 - 223
Target Start/End: Original strand, 24360300 - 24360340
Alignment:
| Q |
183 |
aatatttagatgtgtgtgtgtcttcttgtctttgactccat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24360300 |
aatatttagatgtgtgtgtgtcttcttgtctttgactccat |
24360340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University