View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14874_low_9 (Length: 202)

Name: NF14874_low_9
Description: NF14874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14874_low_9
NF14874_low_9
[»] chr8 (1 HSPs)
chr8 (64-199)||(7673006-7673141)


Alignment Details
Target: chr8 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 64 - 199
Target Start/End: Original strand, 7673006 - 7673141
Alignment:
64 tagggtaagaatgtgcaagacttgatggtaacggttatatgatctagtcttacttatgttgaggtaaaaccaaacagattcaacttctcttcttgtttta 163  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7673006 tagggtaagaatgtgcaagacttgatggtaacggttatatgatctagtcttacttatgttgaggtaaaaccaaacagattcaacttctcttcttgtttta 7673105  T
164 caatgtgatcttcttcaagaatatgacaataatctt 199  Q
    |||||| |||||||||||||||||||||||||||||    
7673106 caatgtaatcttcttcaagaatatgacaataatctt 7673141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University