View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14874_low_9 (Length: 202)
Name: NF14874_low_9
Description: NF14874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14874_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 64 - 199
Target Start/End: Original strand, 7673006 - 7673141
Alignment:
| Q |
64 |
tagggtaagaatgtgcaagacttgatggtaacggttatatgatctagtcttacttatgttgaggtaaaaccaaacagattcaacttctcttcttgtttta |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7673006 |
tagggtaagaatgtgcaagacttgatggtaacggttatatgatctagtcttacttatgttgaggtaaaaccaaacagattcaacttctcttcttgtttta |
7673105 |
T |
 |
| Q |
164 |
caatgtgatcttcttcaagaatatgacaataatctt |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7673106 |
caatgtaatcttcttcaagaatatgacaataatctt |
7673141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University