View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14875_high_24 (Length: 227)
Name: NF14875_high_24
Description: NF14875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14875_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 37817048 - 37816826
Alignment:
| Q |
1 |
tctacaatgtcatacttcagtgtttattaattcactatatttgcttctctgtagatgtgggatagctttatcttcaatggtcttctaatctaatagaata |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37817048 |
tctacaatgtcatactttagtgtttattaattcactatatttgcttctctgtagatgtgggatagctttatcttccatggtcttctaatctaatagaata |
37816949 |
T |
|
| Q |
101 |
taaaagatatcaatccctgatgatgattttacatcatagtactatttgtggatgacatgttgactaatggtcgtgaaattagta--attcaaagcctaaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37816948 |
taaaagatatcaatccctgatgatgattttacatcatattactatttgtggatgacatgttgactaatggtcgtgaaattagtaagattcaaagcctaaa |
37816849 |
T |
|
| Q |
199 |
gaatgatttaagtaagtccttta |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37816848 |
gaatgatttaagtaagtccttta |
37816826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University