View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14875_high_26 (Length: 213)
Name: NF14875_high_26
Description: NF14875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14875_high_26 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 9 - 213
Target Start/End: Complemental strand, 6213496 - 6213292
Alignment:
| Q |
9 |
atgttttaactacttggacttatttttgtcatgtgacgtgacacaatgtatataaaaaatagatgaagacgttgtcatgtgatgcatgtgcagtaaataa |
108 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6213496 |
atgttttaactagttggacttatttttgtcatgtgacgtgacgcagtgtatataaaagatagatgaagacgttgtcatgtgatgcatgtgcagtaaataa |
6213397 |
T |
 |
| Q |
109 |
gtgaattgtattttattaatagtataatacgactatggaagctaatgaactatgattgtatatgtttgagaattttagatggagatgaaggtatgcagcc |
208 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6213396 |
gtgaattgtattttattagtagtataatacgactatggaagctaatgaactatgattgtatatgtttgagaattttagatggagatgaaggtatgcagcc |
6213297 |
T |
 |
| Q |
209 |
gggtt |
213 |
Q |
| |
|
||||| |
|
|
| T |
6213296 |
gggtt |
6213292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University