View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14875_high_28 (Length: 208)
Name: NF14875_high_28
Description: NF14875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14875_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 39975940 - 39976116
Alignment:
| Q |
17 |
aatctcactgtttttattggtgctatgaactcagaaactttgcttaaactatatgttactgcagttaatggctttgctaatgatgtgcttaagaaaacag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39975940 |
aatctcactgtttttattggtgctatgaactcagaaactttgcttaaactatatgttactgcagttaatggctttgctaatgatgtgcttaagaaaacag |
39976039 |
T |
|
| Q |
117 |
gatccaacaatgtcctatgtgtgcatacaaacaaaacacctttgtttggttttgnnnnnnnagggatagtgcctttg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39976040 |
gatccaacaatgtcctatgtgtgcatacaaacaaaacacctttgtttggttttgtttttttagggatagtgcctttg |
39976116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 99 - 167
Target Start/End: Complemental strand, 28538651 - 28538583
Alignment:
| Q |
99 |
atgtgcttaagaaaacaggatccaacaatgtcctatgtgtgcatacaaacaaaacacctttgtttggtt |
167 |
Q |
| |
|
||||||||| |||||| |||||||| | ||||||||||||||||||||| | ||| |||||||| |||| |
|
|
| T |
28538651 |
atgtgcttaggaaaactggatccaaaagtgtcctatgtgtgcatacaaagataactcctttgttaggtt |
28538583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University