View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14875_high_30 (Length: 202)
Name: NF14875_high_30
Description: NF14875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14875_high_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 115 - 188
Target Start/End: Complemental strand, 38051959 - 38051886
Alignment:
| Q |
115 |
cccttgagcttctgtagtaggattcggtccttccacatgcgcttcttcagctcgtcataatcgatttcttcttc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051959 |
cccttgagcttctgtagtaggattcggtccttccacatgcgcttcttcagctcgtcataatcgatttcttcttc |
38051886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 18 - 49
Target Start/End: Complemental strand, 38052056 - 38052025
Alignment:
| Q |
18 |
gtatttgagaattgaatcttgtgctcttgaca |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38052056 |
gtatttgagaattgaatcttgtgctcttgaca |
38052025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University