View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14875_low_15 (Length: 311)
Name: NF14875_low_15
Description: NF14875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14875_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 5 - 295
Target Start/End: Original strand, 46280092 - 46280382
Alignment:
| Q |
5 |
gttttgatcttgctgtgtcggtctctcttgctagatctttttctttggatctgctgatccactacagttttgcctttaccagcagctgcaggaagaagat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46280092 |
gttttgatcttgctgtgtcggtctctcttgctagatctttttctttggatctgctgatccactacagttttgcctttaccagcagctgcaggaagaagat |
46280191 |
T |
 |
| Q |
105 |
tgttgttagctttgattgttgaattggaaggccgctgatgatgatcagtactgttgttattcatgacaacaggtggatgatgaagttggaaatcaacatc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46280192 |
tgttgttagctttgattgttgaattggaaggccgctgatgatgatcagtactgttgttattcatgacaacaggtggatgatgaagttggaaatcaacatc |
46280291 |
T |
 |
| Q |
205 |
atgttgttggaggaagatttgatggctgtcttgaaagggatcaatatcatcatcaggataattagggaattgaaagaaagagaaaggactg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46280292 |
atgttgttggaggaagatttgatggctgtcttgaaagggatcaatatcatcatcaggataattagggaattgaaagaaagagaaaggactg |
46280382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University