View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14875_low_18 (Length: 297)
Name: NF14875_low_18
Description: NF14875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14875_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 291
Target Start/End: Original strand, 46900644 - 46900916
Alignment:
| Q |
19 |
atatgtcatgcttatttttggtttctatcttctatacaagcttgtccttctataaatctgtcatgttctatcttctcgtacctgatactcgtacttggta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46900644 |
atatgtcatgcttatttttggtttctatcttctatacaagcttgtccttctataaatctgtcatgttctatcttctcgtacctgatactcgtacttggta |
46900743 |
T |
 |
| Q |
119 |
ctttataaccttgtccatgcaacataggtgtccagtaattcccacaccgaagtgactgattttttctttcaatcatatcatacaattgaaatttgagtaa |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46900744 |
ccctataaccttgtccatgcaacataggtgtccagtaattcccacaccgaagtgactgattttatctttcaatcatatcatacaattgaaatttgagtaa |
46900843 |
T |
 |
| Q |
219 |
ttgcttttgcttgcgattcggaacaatcaactattatattttgttcatctttccaatcctgtttcgtcctttg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46900844 |
ttgcttttgcttgcgattcggaacaatcaactattatattttgttcatctttccaatcctgtttcgtcttttg |
46900916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University