View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14875_low_21 (Length: 258)
Name: NF14875_low_21
Description: NF14875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14875_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 64 - 242
Target Start/End: Original strand, 34362559 - 34362741
Alignment:
| Q |
64 |
tcctcacccacatctttgatcgtgcagttacaatatat--gttctttgatttattaaaattcaattaga--gttatccatttgttcttccgtgtcaaaga |
159 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||||||| ||||| | ||| |||||||||||| |||||||||| |
|
|
| T |
34362559 |
tcctcacccacatgtttgatcgtgcagttaaaatatatatgttctttgatttattaaaattcatttagacaggtattcatttgttcttctgtgtcaaaga |
34362658 |
T |
 |
| Q |
160 |
aagtaggggaaatgactcaaagaaattacgttgatggtgtttaatagaggaaacttaaaagatagttaacaaatataaatatt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34362659 |
aagtaggggaaatgactcaaagaaattacgttgatggtgtttaatagacgaaacttaaaagatagttaacaaatataaatatt |
34362741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University