View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14875_low_22 (Length: 254)
Name: NF14875_low_22
Description: NF14875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14875_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 43 - 136
Target Start/End: Complemental strand, 16265900 - 16265808
Alignment:
| Q |
43 |
ggggtgctaattagcattttcttattttaaaactaccgtttgaaagggggaaatattctcgaagaataatttgatggctgacaaggtttctata |
136 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16265900 |
ggggtgctagttagcattttcttattttaaaactaccgtttgaa-gggggaaatattctcgaagaataatttgatggctgacaaggttactata |
16265808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 147 - 254
Target Start/End: Complemental strand, 16265584 - 16265476
Alignment:
| Q |
147 |
ttgtttatatgaatcataaatgcattaaatgtggaatgaatggaataatcgatcatatacta-nnnnnnnaatagaatctcccaaaaaattaagagatgg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16265584 |
ttgtttatatgaatcataaatgcattaaatgtggaatgaattgaatgatcgatcatatactattttttttaatagaatctcccaaaaaattaagagatgg |
16265485 |
T |
|
| Q |
246 |
aaggtactt |
254 |
Q |
| |
|
||||||||| |
|
|
| T |
16265484 |
aaggtactt |
16265476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University