View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14876_high_4 (Length: 340)
Name: NF14876_high_4
Description: NF14876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14876_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 2e-43; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 226 - 327
Target Start/End: Complemental strand, 52380322 - 52380221
Alignment:
| Q |
226 |
gagaagactgccctacttaatgggccgggcttgtcattttcactaatgggtacccggtactttttatcaaattaataggctattacttttccgacctatg |
325 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
52380322 |
gagaagactgcactacttaatgggccgggcttgtcattttcactaatgggtacccggtactttttatcaaattaatagactattacttttcccacctatg |
52380223 |
T |
 |
| Q |
326 |
ct |
327 |
Q |
| |
|
|| |
|
|
| T |
52380222 |
ct |
52380221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 52380529 - 52380455
Alignment:
| Q |
1 |
aagaatgaagtgtgaagagggaaaatggaatgaaaatgattatgttgatgcatgtcagaagtgaagaagtgttat |
75 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380529 |
aagaatgaagtgtgaagaaggaaaatggaatgaaaatgattatgttgatgcatgtcagaagtgaagaagtgttat |
52380455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 99 - 135
Target Start/End: Complemental strand, 52380435 - 52380399
Alignment:
| Q |
99 |
agggtttatgattctacggggggtttgatttccctcc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380435 |
agggtttatgattctacggggggtttgatttccctcc |
52380399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University