View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14877_high_15 (Length: 235)
Name: NF14877_high_15
Description: NF14877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14877_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 449882 - 449657
Alignment:
| Q |
1 |
actatctttatttattaattatatggttcgactatgtttcaagtagttgaaccaattgaaccatgactcgaagaattcaatgattcaatctccgatctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
449882 |
actatctttatttattaattatatggttcgactatgcttcaagtagttgaaccaattgaaccataactcgaagaattcaatgattcaatctccgatctgg |
449783 |
T |
 |
| Q |
101 |
ttttcaaaaaattggttaaaagaggttcttccaaatcaattttcacttcctctgtctcattaaccatagattttggaactatcttctctttaacatcaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
449782 |
ttttcaaaaaattggttaaaagaggttcttccaaatcaattttcacttcctctgtctcattaaccatagattttggaactatcttctctttaacatcaac |
449683 |
T |
 |
| Q |
201 |
tacttcttcagctttaccccaaagta |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
449682 |
tacttcttcagctttaccccaaagta |
449657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 164 - 226
Target Start/End: Complemental strand, 469129 - 469067
Alignment:
| Q |
164 |
ccatagattttggaactatcttctctttaacatcaactacttcttcagctttaccccaaagta |
226 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
469129 |
ccatagattttggaactatattctctttaatatcaactacttcttcagctttaccccaaagta |
469067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 138 - 224
Target Start/End: Complemental strand, 475702 - 475616
Alignment:
| Q |
138 |
aattttcacttcctctgtctcattaaccatagattttggaactatcttctctttaacatcaactacttcttcagctttaccccaaag |
224 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| ||||||||| ||| |||| ||||| ||||| |||||||||||||| |
|
|
| T |
475702 |
aattttcacttcctctgtctgagtaaccatagattttggatctatcttctgtttgacatggactacatcttccgctttaccccaaag |
475616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 117 - 150
Target Start/End: Complemental strand, 469161 - 469128
Alignment:
| Q |
117 |
taaaagaggttcttccaaatcaattttcacttcc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
469161 |
taaaagaggttcttccaaatcaattttcacttcc |
469128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 226
Target Start/End: Complemental strand, 481303 - 481249
Alignment:
| Q |
172 |
tttggaactatcttctctttaacatcaactacttcttcagctttaccccaaagta |
226 |
Q |
| |
|
|||||| || |||||||||| || ||| |||| |||||||||||||||||||||| |
|
|
| T |
481303 |
tttggatctgtcttctctttgacttcagctacatcttcagctttaccccaaagta |
481249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 224
Target Start/End: Original strand, 27489249 - 27489324
Alignment:
| Q |
149 |
cctctgtctcattaaccatagattttggaactatcttctctttaacatcaactacttcttcagctttaccccaaag |
224 |
Q |
| |
|
|||||||| ||||||| ||||||||| || | ||||||||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
27489249 |
cctctgtcgcattaacgatagatttttgatttcccttctctttcacatcaactacatcttcagcttttccccaaag |
27489324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University