View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14877_low_12 (Length: 301)
Name: NF14877_low_12
Description: NF14877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14877_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 287
Target Start/End: Original strand, 50219887 - 50220172
Alignment:
| Q |
3 |
ttgaaatacgggatgaaatctgctagacataatatgcatattgtgaaacagaagtattctgctaatgcatatcgtctctttcccctaacnnnnnnntaca |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
50219887 |
ttgaaatacgagatgaaatctgctagacataatatgcatattgtgaaacagaagtattctgcaaatgcatatcgtctctttcccctaacaaaaaaataca |
50219986 |
T |
 |
| Q |
103 |
tatcatctcatttgttttgtttgcagttttcaccacgctcattgttcttgtaagtaatggagtaactaacaaagctaaactaaaagtaaaaacatattt- |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50219987 |
tatcatctcatttgttttgtttgcagttttcaccacgctcattgttcttgtaagtaatggagtaactaacaaagctaaactaaaagtaaaaacatattta |
50220086 |
T |
 |
| Q |
202 |
nnnnnnnnnnnnggaaagaatctaaactaacaacaattagaccaataaaagtatatgtagaataggcaactaccaatagtataaag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50220087 |
aaaaaaagaaaaggaaagaatctaaactaacaacaattagaccaataaaagtatatgtagaataggcaactaccaatagtataaag |
50220172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University