View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14877_low_15 (Length: 240)
Name: NF14877_low_15
Description: NF14877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14877_low_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 240
Target Start/End: Original strand, 32266438 - 32266658
Alignment:
| Q |
20 |
cacagttactagttttgccgttgtttctcaagctttgacagaactcaaccttatgagtacggagctagggcaaattgctttatcttcagcaatgatcact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32266438 |
cacagttactagttttgccgttgtttctcaagctttgacagaactcaaccttatgagtacggagctagggcaaattgctttatcttcagcaatgatcact |
32266537 |
T |
|
| Q |
120 |
gaaatgatgcaatgggttacgataacactacaaatacaagtcaaaactatgaagtttaaaaatatcttttttgcgttcattgccttgggtttatgcgtcg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32266538 |
gaaatgatgcaatgggttacgataacactacaaatacaagtcaaaactatgaagtttaaaaatatcttttttgcgttcattgccttgggtttatgtgtct |
32266637 |
T |
|
| Q |
220 |
tatatattttatccttctttt |
240 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32266638 |
tatatattttatccttctttt |
32266658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University