View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14877_low_8 (Length: 384)
Name: NF14877_low_8
Description: NF14877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14877_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 338
Target Start/End: Complemental strand, 24523515 - 24523178
Alignment:
| Q |
1 |
tgttgaaggtggggtccagtggcagcacggatccacactttaaacttgttctcatcggcgtatccacagctgagacggaactttcgaatgttgcgggatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24523515 |
tgttgaaggtggggtccagtggcagcacggatccacactttaaacttgttctcatcggcgtatccacagctgagacggaactttcgaatgttgcgggatc |
24523416 |
T |
|
| Q |
101 |
tgcggagagcgagcacactgtcaacgtaataggcaaactttttgaactttttgtaattactgccatggggggtgtcgaagaccgggtccgagtccttaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24523415 |
tgcggagagcgagcacactgtcaacgtaataggcaaactttttgaactttttgtactcacagtcatggggggtgtggaagaccgggtccgagtccttaaa |
24523316 |
T |
|
| Q |
201 |
attgaagacctgaagttgctcccaaaggttgcgccactttcgagagacgagactcatcgttgccacggaggttcttgttggtaggaaggagagtatatgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24523315 |
gttgaagacctgaagttgctcccaaaggttgcgccactttcgagaagcgagactcatcgttgccacggaggttcttgttggtaggaaggagagtatatgc |
24523216 |
T |
|
| Q |
301 |
aacaacagtggatccggcagagtgcttatcctgtcgat |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24523215 |
aacaacagtggatccggcagagtgcttatcctgtcgat |
24523178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 232 - 328
Target Start/End: Original strand, 25032301 - 25032397
Alignment:
| Q |
232 |
cgccactttcgagagacgagactcatcgttgccacggaggttcttgttggtaggaaggagagtatatgcaacaacagtggatccggcagagtgctta |
328 |
Q |
| |
|
|||||| | ||||||| ||||||| | ||||||||||||||||| ||||| ||||| ||||||||||| || | ||||| ||||| |||| ||||| |
|
|
| T |
25032301 |
cgccacctgcgagagatgagactcgttgttgccacggaggttctggttgggaggaatgagagtatatggaagaggagtgggtccggtagagggctta |
25032397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 204 - 299
Target Start/End: Complemental strand, 30076897 - 30076802
Alignment:
| Q |
204 |
gaagacctgaagttgctcccaaaggttgcgccactttcgagagacgagactcatcgttgccacggaggttcttgttggtaggaaggagagtatatg |
299 |
Q |
| |
|
||||||||| || |||||||| |||| |||||| | ||||||||||| |||| ||||| |||||||||| ||||| |||||||| |||||||| |
|
|
| T |
30076897 |
gaagacctggagatgctcccagaggtgtcgccacctgtgagagacgagagtcatggttgcgacggaggttcgagttgggaggaaggatagtatatg |
30076802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 3 - 107
Target Start/End: Complemental strand, 30077086 - 30076982
Alignment:
| Q |
3 |
ttgaaggtggggtccagtggcagcacggatccacactttaaacttgttctcatcggcgtatccacagctgagacggaactttcgaatgttgcgggatctg |
102 |
Q |
| |
|
|||||||||||| |||||||| ||||||| ||||| | |||| | || ||| | ||| ||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
30077086 |
ttgaaggtggggaccagtggcggcacggaaccacagctcaaacattttgggatccgggtaatcacagttgagacggaacttccgaatgttgcgggatcta |
30076987 |
T |
|
| Q |
103 |
cggag |
107 |
Q |
| |
|
||||| |
|
|
| T |
30076986 |
cggag |
30076982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University