View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14878_high_11 (Length: 278)
Name: NF14878_high_11
Description: NF14878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14878_high_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 47 - 278
Target Start/End: Complemental strand, 40160549 - 40160320
Alignment:
| Q |
47 |
atttattctaatctacaaaagcactatagaaaatggttaagattnnnnnnnnnnnnnnnnnacttccattacttagagccctttatctccccctccgaac |
146 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||| |||||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
40160549 |
atttattctaatctagaaaagcactatagaaaatggttaatatttctctctttttctctctacttcccttacttagagccctt-atctcccc-tccgaac |
40160452 |
T |
 |
| Q |
147 |
ttccaaacaacccttaaataaaatgatgtgaatttcgtaaaataaaaatttgtttgtaatcaaaagcaattttgtttaacaaaatgcagatagagttgat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40160451 |
ttccaaacaacccttaaataaaatgatgtgcatttcgtaaaaaaaaaaattgtttgtaatcaaaagcaatgttgtttaacaaaatgcagatagagttgat |
40160352 |
T |
 |
| Q |
247 |
tgtagaaaatgaggtactgtttagtgttgaac |
278 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
40160351 |
tgtagaaaatgaggtactgtttagtattgaac |
40160320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 10 - 46
Target Start/End: Original strand, 18141749 - 18141785
Alignment:
| Q |
10 |
atgaagcaaagaaaagaatcggttatatttttcatat |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18141749 |
atgaagcaaagaaaagaatcggttatatttttcatat |
18141785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University