View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14878_high_13 (Length: 268)
Name: NF14878_high_13
Description: NF14878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14878_high_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 108 - 268
Target Start/End: Original strand, 1332759 - 1332930
Alignment:
| Q |
108 |
aagagtttagtggccaaactcacacacattagaattagtttatgatagt-----------taattacaataagtgtggggtgatctttatatatagatcc |
196 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1332759 |
aagagtttagtggcgaaactcacacacattagaattagtttatgttagttgcaagttagttaattacaataagtgtggggtgatctttatatatagatcc |
1332858 |
T |
 |
| Q |
197 |
aaaaataactagaataactaactagaaactaatttcactatccctataagcttaactcaattggtagggaca |
268 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1332859 |
aaaaataactagaagacctaactagaaactaatttaactatccctataagcttagctcaattggtagggaca |
1332930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University