View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14878_high_9 (Length: 291)
Name: NF14878_high_9
Description: NF14878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14878_high_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 16 - 291
Target Start/End: Complemental strand, 37548387 - 37548112
Alignment:
| Q |
16 |
aaaattatcactagattgctaattgcaatgctccattttatccttgttaagatgggttcacacgaagttagcatatttgttgatgtgagttgctaggcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37548387 |
aaaattatcactagattgctaattgcaatgctccattttatccttgttaagatgggttcacacgaagttagcatatttgttgatgtgagttgctaggcaa |
37548288 |
T |
|
| Q |
116 |
taagttatatgtggtgggaaacaaaaagtctacagcgggaaatttatctacattgaaatcttaatcactcatttattcatatactggtgaggatttcgat |
215 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37548287 |
taagttaaatgtggtgggaaacaaaaagtctacagcgggaaatttatctacattgaaatcttaatcactcatttattcatatactggtgaggatttcgat |
37548188 |
T |
|
| Q |
216 |
tgaactccttctggtgataattccacggtcccagtgttgtaaacaataacaaattgaatttttgtatgaaaataat |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37548187 |
tgaactccttctggtgataattccacggtcccagtgttgtaaacaataacaaattgaatttttgtatgaaaataat |
37548112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University