View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14878_low_9 (Length: 354)
Name: NF14878_low_9
Description: NF14878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14878_low_9 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 9e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 167 - 354
Target Start/End: Complemental strand, 37547922 - 37547735
Alignment:
| Q |
167 |
cagtgttgttgtcacgtgctctttggttgatgtcgtcattatgctcctttgattgtttgccgtcgttgtctcaattcatattccttagcttgtatcactt |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37547922 |
cagtgttgttgtcacgtgctctttggttgatgtcgtcattatgctcctttgattgtttgccgtcgttgtctcaattcatattccttagcttgcatcactt |
37547823 |
T |
 |
| Q |
267 |
ccgttatttctttcaaaccaaatggaggatatgataaaatcaaataggaccaactaacattcacatttattacccgatcgcaatcaat |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37547822 |
ccgttatttctttcaaaccaaatggaggatatgataaaatcaaataggaccaactaacattcacatccattacccgatcgcaatcaat |
37547735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 6 - 44
Target Start/End: Complemental strand, 37547962 - 37547924
Alignment:
| Q |
6 |
taaaaattaaatcttgtttttgaaatgatcattgaaaat |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37547962 |
taaaaattaaatcttgtttttgaaatgatcattgaaaat |
37547924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University