View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14879_high_11 (Length: 306)
Name: NF14879_high_11
Description: NF14879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14879_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 37 - 291
Target Start/End: Complemental strand, 40353076 - 40352823
Alignment:
| Q |
37 |
aactaatttattcagatttatattattgtttcttttgtaagggtgatcaatgatcattgttacttctacagaaaatagatctgcctataagtacaatatt |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||| |||||||||||||||| |
|
|
| T |
40353076 |
aactaatttattcagatttatattattgtttcttttgtaagggtgatcaatgatcgttgttacttctacaggaaacagatctgtctataagtacaatatt |
40352977 |
T |
 |
| Q |
137 |
cactcaagtttcagaaccttctattaaaagatgattttgttatactaattgacaaagacacctcgttaaattatggaatttatcaggtatgttaatgtga |
236 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
40352976 |
cactca-gtttcagaaccttttattaaaagatgattttgttatactaattgacaaagacgcctcgctaaattatggaatttatcaggtatgttaatgcga |
40352878 |
T |
 |
| Q |
237 |
cagtgactgtgcttcatagaacactaacacatctaaataaaacaacgacaaatac |
291 |
Q |
| |
|
|| |||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
40352877 |
caatgactgtgcttcatagaacactaacatattcaaataaaacaacgacaaatac |
40352823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University