View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14879_high_12 (Length: 290)
Name: NF14879_high_12
Description: NF14879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14879_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 266
Target Start/End: Original strand, 39149981 - 39150238
Alignment:
| Q |
15 |
tatcccaacacgtaaatacgttcataattcactaacctctttttatttccatttatatacaaaccatacaaaacacgtttg----catgagtcttttcta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39149981 |
tatcccaacacgtaaatacgttcataattcactaacctctttttatttccatttatatacaaaccatacaaaacacgtttgtttgcatgagtcttttcta |
39150080 |
T |
|
| Q |
111 |
tattctc--tctctctttctactatctcaccatctgtgcctcacctattttgccacgtgtaacccaccttttatggttcaccacgttgcgtgttgcgtgg |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39150081 |
tattctctctctctctttctactatctcaccatctgtgcctcacctattgtgccacgtgtaacccaccttttatggttcaccacgttgcgggttgcgtgg |
39150180 |
T |
|
| Q |
209 |
tccatcacctaagggtcatatcataggcaattcaccaaatattccaaactatatatat |
266 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39150181 |
tccatcacctaagggtcatattataggcaattcaccaaatattccaaactatatatat |
39150238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University