View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14879_high_20 (Length: 250)
Name: NF14879_high_20
Description: NF14879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14879_high_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 28603610 - 28603390
Alignment:
| Q |
14 |
caaaggtagaaaaatcccttgatgcaccataattaagttgggtaaccatgatgaataggtagaaaaatcccttgatgcaacaataattaagttgggcaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28603610 |
caaaggtagaaaaatcccttgatgcaccatgattaagttgggtaaccatgatgaataggttgaaaaatcccttgatgcaacaataattaagttgggcaaa |
28603511 |
T |
 |
| Q |
114 |
catgatgaatgag--atattggagttagttatgcagtattaaaaaggctgcaaaaatttatgcattgaatgagaaggtgaatggatatgttatttcaact |
211 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28603510 |
catgatgaatgagatatattggagttagttatgcagtattaaaaaggctgcaaaaatttatgcattgaatgagaaggtgaatggatatgttatttcaact |
28603411 |
T |
 |
| Q |
212 |
atcctcactgcacgtcaagtt |
232 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28603410 |
atcctcactgcacgtcaagtt |
28603390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University