View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14879_high_22 (Length: 236)
Name: NF14879_high_22
Description: NF14879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14879_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 91 - 230
Target Start/End: Complemental strand, 40050146 - 40050006
Alignment:
| Q |
91 |
ttgcatatcttataatcctcttttgataatagaggttaata-aacccaaagaaactaaaaatgcttctaaacccacaaaaattacggggagcatctaaat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40050146 |
ttgcatatcttataatcctcttttgataatagaggttaatataactcaaagaaactaaaaatgcttctaaacccaaaaaaattacggggagcatctaaat |
40050047 |
T |
|
| Q |
190 |
tattaaaaaccctagaaaactaattaaataggtcacataat |
230 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40050046 |
tattaaaaaccctagaaaactaattaactaggtcacataat |
40050006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 137 - 195
Target Start/End: Original strand, 33250778 - 33250835
Alignment:
| Q |
137 |
aaagaaactaaaaatgcttctaaacccacaaaaattacggggagcatctaaattattaa |
195 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | |||| ||||||| | ||||||| |
|
|
| T |
33250778 |
aaagaaactaaaa-tgcttctaaacccacaaaaactccgggcagcatctgatttattaa |
33250835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 91 - 156
Target Start/End: Original strand, 1616739 - 1616805
Alignment:
| Q |
91 |
ttgcatatcttataatcctcttttgataatagaggttaata-aacccaaagaaactaaaaatgcttc |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1616739 |
ttgcatatcttataatcctcttttgataatagaggttaatataacccaaagaaactaaaaatgcttc |
1616805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University