View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1487_high_9 (Length: 286)
Name: NF1487_high_9
Description: NF1487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1487_high_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 16 - 286
Target Start/End: Complemental strand, 38411369 - 38411099
Alignment:
| Q |
16 |
attgtgactttgatagaggaaacttttctgtgtatttctattgttaatgtaccaactgcaacgctccatgttccaatttttgtcaactcataacctcttt |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38411369 |
attgtgactttggtagaggaaacttttctgtgtatttctattgttaatgtaccaactgcaacgctccatgttccaatttttgtcaactcataaactcttt |
38411270 |
T |
 |
| Q |
116 |
aagtcaccgcatgacatatttgacttcttcgtttgttttcgcagtttgtgatcctaagagcctactcttcgtatttggaatgcaattagactacagtgat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38411269 |
aagtcaccgcatgacatatttgacttcttcgtttgttttcgcagtttgtgatcctaagagcctactcttcgtatttggaatgcaattagactacagtgat |
38411170 |
T |
 |
| Q |
216 |
gctctgatcgggggaggcttcaatttcaagaatcctaatgcgacacaaacctgtggatgtggtaaatcatt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38411169 |
gctctgatcgggggaggcttcaatttcaagaatcctaatgcgacacaaacctgtggatgtggtaaatcatt |
38411099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University