View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1487_low_17 (Length: 221)
Name: NF1487_low_17
Description: NF1487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1487_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 14 - 122
Target Start/End: Original strand, 51530083 - 51530191
Alignment:
| Q |
14 |
aaaataaaaaccatagtattggtgacactcgtcgtgtctattacatttcaaagttctaaaatggaactatgttcctcaaaacagccatccacaacaacac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51530083 |
aaaataaaaaccatagtattggtgacactcgtcgtgtctattacatttcaaagttctaaaatggaactatgttcctcaaaacagccatccacaacaacac |
51530182 |
T |
|
| Q |
114 |
tctcaataa |
122 |
Q |
| |
|
||||||||| |
|
|
| T |
51530183 |
tctcaataa |
51530191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 40 - 122
Target Start/End: Original strand, 51523802 - 51523884
Alignment:
| Q |
40 |
actcgtcgtgtctattacatttcaaagttctaaaatggaactatgttcctcaaaacagccatccacaacaacactctcaataa |
122 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51523802 |
actcatcgtgtctattatatttcaaagttctaaaatggaactatgttcctcaaaacagccatccacaacaacactctcaataa |
51523884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University