View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1487_low_19 (Length: 210)
Name: NF1487_low_19
Description: NF1487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1487_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 66 - 192
Target Start/End: Original strand, 28388793 - 28388919
Alignment:
| Q |
66 |
tggttgttgcatggtcgtctcaagattggataataatgtgcaattgttttatgatctagtggaatgaaatattatgtggttgttgcacatgagcataatc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28388793 |
tggttgttgcatggtcgtctcaagattggataataacgtgcaattgttttatgatctagtggaatgaaatattatgtggttgttgcacatgagcataacc |
28388892 |
T |
|
| Q |
166 |
ctttggcattagatactaaattggtat |
192 |
Q |
| |
|
|||||||||||||| ||||||||||| |
|
|
| T |
28388893 |
ctttggcattagatgataaattggtat |
28388919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University