View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1487_low_6 (Length: 346)
Name: NF1487_low_6
Description: NF1487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1487_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 1 - 331
Target Start/End: Original strand, 6515646 - 6515980
Alignment:
| Q |
1 |
tgagcagtatggtatggcatgcagagaagctgtcttagcaaaactgaaggtaacatcat----aatgttatgaaaattatgcttgaatttaactttaaac |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6515646 |
tgagcagtatggtatggcatgcagagaagctgtcttagcaaaactgaaggtaacatcattcataatgttatgaaaattatgcttgaatttaactttaaac |
6515745 |
T |
 |
| Q |
97 |
aaatagatttaataaattaatgnnnnnnntagtctaaaagacgattatttttcatttaggcaagtgaaattgaaaagtttagagaagaagaagagcaaaa |
196 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6515746 |
aaatagatttaataaattaatgaaaaaaatagtctaaaagacgattatttttcatttaggcaagtgaaattgaaaagtttagagaagaagaagagcaaaa |
6515845 |
T |
 |
| Q |
197 |
tgttgaaaaagcaaggcttgctgaagaggctgcattagctttagctgaagtagagacacagaaagcaaaagctgctttggaagcggccgaaatgtcacag |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6515846 |
tgttgaaaaagcaaggcttgctgaagaggctgcattagctttagctgaagtagaaacacagaaagcaaaagctgctttggaagcggccgaaatgtcacag |
6515945 |
T |
 |
| Q |
297 |
cgtcttgcggaaatagaaactcaaaagagaaagct |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6515946 |
cgtcttgcggaaatagaaactcaaaagagaaagct |
6515980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University