View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14880_high_9 (Length: 252)
Name: NF14880_high_9
Description: NF14880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14880_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 8 - 191
Target Start/End: Original strand, 35747502 - 35747687
Alignment:
| Q |
8 |
atgaagaaataaaca--agttggtcttgttgataagaatttaacttataattgtaaatgtgtgtctttttggcttctttaacaataaaaaatcataaatg |
105 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35747502 |
atgaagaaataaacataagttggtcttgttgataagaatttgacttataattgtaaatgtgtgtctttttggcttcttcaacaataaaaaatcataaatg |
35747601 |
T |
 |
| Q |
106 |
tgtggactaagttctcgctgtcaaaatgaagatcttactgatgagtacacgtcagcgcaatttgaacatttagacttatcatataa |
191 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35747602 |
tgtggattaagttctcgctgtcaaaatgaagatcttactgatgagtatacgtcagcgcaatttgaacatttagacttatcatataa |
35747687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University