View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14880_low_9 (Length: 275)

Name: NF14880_low_9
Description: NF14880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14880_low_9
NF14880_low_9
[»] chr5 (1 HSPs)
chr5 (1-259)||(40440608-40440866)


Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 40440866 - 40440608
Alignment:
1 tcacaaaacatgcaaaggtgattggccttctggtcagctaatctgctgcatagtaagttcgattggatataatgaataaaggttttgagggaatatgtgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
40440866 tcacaaaacatgcaaaggtgattggccttctggtcagctaatctgttgcatagtaagttcgattggatataatgaataaaggttttgagggaataggtgt 40440767  T
101 ggtcacatgtaagtttttggttgttgtggtattggtggggttaggtttagtgtttgaggatggaggtttgaaaggtgaacagggagggtgatttaagggt 200  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||    
40440766 ggtcacatgtaagtttttggttgtggtggtattggtggggttaggtttagtgtttgaggatggaggtttgaaaggtgaatagggagggtgattgaagggt 40440667  T
201 ttaaggggtgcatgtttggatgatttatagggacaagctaagcttgcagcttgttgtat 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40440666 ttaaggggtgcatgtttggatgatttatagggacaagctaagcttgcagcttgttgtat 40440608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University