View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14882_high_18 (Length: 238)
Name: NF14882_high_18
Description: NF14882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14882_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 21252912 - 21252693
Alignment:
| Q |
18 |
gtaaaaagttatttttaaaatttcttggaaacacata--aaaatgcatatttcatgacatatctataccgtaagatcttgtagacatcctgctatgattc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
21252912 |
gtaaaaagttatttttaaaatttcttggaaacacatataaaaatgcatatttcatgacatatctataccgtaaaatcttgtagacatcctgcaatgattc |
21252813 |
T |
 |
| Q |
116 |
acatctccctactattgaaaacgtgatatgatatgatatgatcgaaaatgagggaatcaacaaatcaaagcgtctaggatagtaaggatccctttgaaga |
215 |
Q |
| |
|
| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| | ||||||| |
|
|
| T |
21252812 |
atttctccatcctattgaaaacgtgatatgatatgatatgatcgaaaatgagggaatcaacaaatcaaagcatctaggaaagtaaggatctccttgaaga |
21252713 |
T |
 |
| Q |
216 |
tgctcttagtatttattttt |
235 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
21252712 |
tgctcttagtattttttttt |
21252693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University