View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14882_low_12 (Length: 357)
Name: NF14882_low_12
Description: NF14882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14882_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 18 - 343
Target Start/End: Original strand, 49739785 - 49740110
Alignment:
| Q |
18 |
aaaaaatgtatatggaaagtatcacacaccatccactaattaaattaacacttggaagttgtaatcattcatccttgaattatgtttgaactatgaatag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49739785 |
aaaaaatgtatatggaaagtatcacacaccatccactaattaaattaacacttggaagttgtaatcattcatccttgaattatgtttgaactatgaatag |
49739884 |
T |
|
| Q |
118 |
atatcaaatttcaactgtagttagatggttctagactatctgagaagnnnnnnnncccctgttatttgtcactttaatagtgtacggtacagttcctttg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49739885 |
atatcaaatttcaactgtagttagatggttctagactatctgagaagttttttttcccctgttatttgtcactttaatagtgtacggtacagttcctttg |
49739984 |
T |
|
| Q |
218 |
atatcacatgaagtaaattaagaaattgctttaaaatttatattttcaattccatttttagctcttcaagcataactctttaatcaatccattgcttaca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49739985 |
atatcacatgaagtaaattaagaaattgctttaaaatttatattttcaattccatttttagctcttcaagcataactctttaatcaatccattgcttaca |
49740084 |
T |
|
| Q |
318 |
taaatatgaacctttccaagaataat |
343 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
49740085 |
taaatatgaacctttccaagcataat |
49740110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University