View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14882_low_19 (Length: 240)
Name: NF14882_low_19
Description: NF14882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14882_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 6 - 225
Target Start/End: Original strand, 30997861 - 30998085
Alignment:
| Q |
6 |
cacagacacaaaatcgatgcgcagaatcaattacatcatcaaaaatgttgaa----cataagagcttcaaacataataaataaacataacgaaactatga |
101 |
Q |
| |
|
|||| |||||||||| | ||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30997861 |
cacaaacacaaaatctaagcgcagaatcaattacatcatcaaacatgctgaaatttcataagagcttcaaacataataaataaacataacgaaactatga |
30997960 |
T |
 |
| Q |
102 |
ataatccacgaag---attgaaagatgaagaaaacccnnnnnnngaatcttttgagagacccaaaatagaatttatatattgaaggcgtataaaccaacg |
198 |
Q |
| |
|
||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30997961 |
ataatccacgaagaaaattgaaagatgaagaaaatccaaaaaaagaatcttttgagagacccaaaatagaatt--tatattgaaggcgtataaaccaacg |
30998058 |
T |
 |
| Q |
199 |
ttgatggaaaaggttaagcatctttac |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30998059 |
ttgatggaaaaggttaagcatctttac |
30998085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University