View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14882_low_21 (Length: 206)
Name: NF14882_low_21
Description: NF14882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14882_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 28587427 - 28587254
Alignment:
| Q |
15 |
gagatgaaagatgtaggaaagcaagaatttgttgcttcactgcgaaggtttgaatgagctagcctattatattatcagcactacaattcaatgcctcacc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28587427 |
gagatgaaagatgtaggaaagcaagaatttgttgcttcactgcgaaggtttgaatgagctagcctattatattatcagcactataattcaatgcctcacc |
28587328 |
T |
|
| Q |
115 |
taaaattgtaattcttctgcttgcaggacaagcactggtttttcgaggggagcttccaagtacaggggtgttac |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28587327 |
taaaattgtaattcttctgcttgcaggacaagcactggtttttcgaggggagcttccaagtacaggggtgttac |
28587254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University