View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14882_low_22 (Length: 206)
Name: NF14882_low_22
Description: NF14882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14882_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 18 - 104
Target Start/End: Complemental strand, 24563855 - 24563769
Alignment:
| Q |
18 |
atatgcagtattttactcaactcgtgaccgaattctaaattaacatgacccttttttcgtgaacacctgatggttaataagacaaaa |
104 |
Q |
| |
|
||||||| ||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
24563855 |
atatgcaatattttacttaactcgcgaccgaactctaaattaacatgacccttttttcgtgaacacccgacggttaataagacaaaa |
24563769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 139 - 192
Target Start/End: Complemental strand, 24563733 - 24563680
Alignment:
| Q |
139 |
tcataaacttatgttagtggtatttgaatttaacagattggaatctgatgaaca |
192 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24563733 |
tcataaacttatgttagttgtatttgaatttaacagattggaatctgatgaaca |
24563680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University