View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14883_low_6 (Length: 304)
Name: NF14883_low_6
Description: NF14883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14883_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 45 - 295
Target Start/End: Complemental strand, 45300003 - 45299749
Alignment:
| Q |
45 |
cactaatttaaattccctgcagaaatcatgcatttgcatttgagacattgataaccgtccgatcttgataataataggacggttcaaaaatgcatatttt |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
45300003 |
cactaatttaaattccctgcagaaatcatgcatttgcatttgagatattgatgaccgtccgatcttgataataataggacggttcaaaaatacatatttt |
45299904 |
T |
|
| Q |
145 |
aattttgattgtataattcaaaatatcgagcttaaatctgaatcatctaaacttaatcaaacggccgctaacgtctca---aatgtgtgagtgcatgg-a |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| ||||| |||| |||||||| ||| | |
|
|
| T |
45299903 |
aattttgattgtataattcaaaatattgagcttaaatttgaatcatctaaacttaatcaaacggccgctaacatctcaaataatgcgtgagtgcgtggaa |
45299804 |
T |
|
| Q |
241 |
tcttagccgccggtcctnnnnnnncctgtttatagtatattatctgttctttgcc |
295 |
Q |
| |
|
|||||||||||| ||| || |||||||||||||||||||||||||||| |
|
|
| T |
45299803 |
tcttagccgccgatcccaaaaaaacccgtttatagtatattatctgttctttgcc |
45299749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 118 - 159
Target Start/End: Complemental strand, 37660119 - 37660076
Alignment:
| Q |
118 |
ataggacggttcaaaaa--tgcatattttaattttgattgtata |
159 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
37660119 |
ataggacggtccaaaaaactgcatattttaattttgattgtata |
37660076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University