View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14883_low_9 (Length: 205)
Name: NF14883_low_9
Description: NF14883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14883_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 28313972 - 28313794
Alignment:
| Q |
1 |
tatgaaacattgaaggacaatggagaaagatgcaagtcatttgattggggtccatttactgttgtttgatggcttagttatttaaaatggccgtatgtga |
100 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28313972 |
tatgaaacgttgaaggagaatggagaaagatgcaagtcatttgattggggtccatttactgttgtttgatggcttagttatttaaaatggccgtatgtga |
28313873 |
T |
 |
| Q |
101 |
agaatttcaatatttttaacgtcgatcaaacatgtatttagtaggactctctaaattttgttagattattacttttttc |
179 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28313872 |
agaatttcaatatttttaacgtggatcaaacatgtatttagtaggactctctaaattttgttagattattacttttttc |
28313794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University