View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14885_high_26 (Length: 230)
Name: NF14885_high_26
Description: NF14885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14885_high_26 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 33512651 - 33512880
Alignment:
| Q |
1 |
ataatcaacatggttcatcaaggtttagtattggaagcagctttaggaaaattggaaaagctactactatatttaaggaagaagaaaaaggtattatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512651 |
ataatcaacatggttcatcaaggtttagtattggaagcagctttaggaaaattggaaaagctactactatatttaaggaagaagaaaaaggtattatttc |
33512750 |
T |
 |
| Q |
101 |
aaaggaagaagaattgcttatagaaaaaagtgattctaacaataaagcttatcataagcataatcacaagattactatatctgatgttgtgtttaagcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512751 |
aaaggaagaagaattgcttatagaaaaaagtgattctaacaataaagcttatcataagcataatcacaagattactatatctgatgttgtgtttaagcat |
33512850 |
T |
 |
| Q |
201 |
agatggagcaatgttagttcttctgatctt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33512851 |
agatggagcaatgttagttcttctgatctt |
33512880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University