View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14885_high_28 (Length: 213)
Name: NF14885_high_28
Description: NF14885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14885_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 23 - 156
Target Start/End: Original strand, 26886985 - 26887117
Alignment:
| Q |
23 |
taatggaagaaagtgagtaacttagaaaatgaatatgaagtagagaaggtggtagggatatgattttataggaaatagtattctttttatgatgagttct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26886985 |
taatggaagaaagtgagtaacttagaaa-tgaatatgaagtagagaaggtggtggagatatgattttataggaaatagtattctttttatgatgagttct |
26887083 |
T |
 |
| Q |
123 |
agcacacacaaatcatgttttcttgtcacagaat |
156 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| |
|
|
| T |
26887084 |
agcgcacacaaatcatgttttcttgtcacagaat |
26887117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University