View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14885_high_28 (Length: 213)

Name: NF14885_high_28
Description: NF14885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14885_high_28
NF14885_high_28
[»] chr7 (1 HSPs)
chr7 (23-156)||(26886985-26887117)


Alignment Details
Target: chr7 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 23 - 156
Target Start/End: Original strand, 26886985 - 26887117
Alignment:
23 taatggaagaaagtgagtaacttagaaaatgaatatgaagtagagaaggtggtagggatatgattttataggaaatagtattctttttatgatgagttct 122  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||    
26886985 taatggaagaaagtgagtaacttagaaa-tgaatatgaagtagagaaggtggtggagatatgattttataggaaatagtattctttttatgatgagttct 26887083  T
123 agcacacacaaatcatgttttcttgtcacagaat 156  Q
    ||| ||||||||||||||||||||||||||||||    
26887084 agcgcacacaaatcatgttttcttgtcacagaat 26887117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University