View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14885_low_21 (Length: 275)
Name: NF14885_low_21
Description: NF14885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14885_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 257
Target Start/End: Complemental strand, 49614883 - 49614641
Alignment:
| Q |
20 |
atcgttactgggtaaccattatctc--attaattcacaccactacttttttagtt----tgtttctcaattctcttttaatccctttaccttttcaggct |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
49614883 |
atcgttactgggtaaccattatctctcattaattcacaccactacttttttttttgttttgtttctcaaatctcttt-aatccctttaccttttcaggct |
49614785 |
T |
|
| Q |
114 |
gaagagcttcccaacgacgacggaactatctgcgtatacaccaccgatgcttccaccttctacggatttgttgccttctccttccttcttgtaaatcaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49614784 |
gaagagcttcccaacgacgacggaactatctgcgtatacaccaccgatgcttccaccttctacggatttgttgccttctccttccttcttgtaaatcaag |
49614685 |
T |
|
| Q |
214 |
ttttccttaacctcatcactagatgtttctgttgcgggaaaggt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49614684 |
ttttccttaacctcatcactagatgtttctgttgcgggaaaggt |
49614641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 93 - 257
Target Start/End: Complemental strand, 49609726 - 49609561
Alignment:
| Q |
93 |
atccctttac-cttttcaggctgaagagcttcccaacgacgacggaactatctgcgtatacaccaccgatgcttccaccttctacggatttgttgccttc |
191 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||||| | ||||| ||||||||| || ||| ||| |||| ||||||| ||||||| |||| ||||||| |
|
|
| T |
49609726 |
atccctttacgcttttcaggccttagagattcccaatgtcgacgaaactatctgtgtttacgacactgatgattccaccatctacggctttggtgccttc |
49609627 |
T |
|
| Q |
192 |
tccttccttcttgtaaatcaagttttccttaacctcatcactagatgtttctgttgcgggaaaggt |
257 |
Q |
| |
|
| || ||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
49609626 |
ttctgccttcttataaatcaagttttccttaacctcatcactagatgtttctgctgcggtaaaggt |
49609561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University