View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14886_high_1 (Length: 405)
Name: NF14886_high_1
Description: NF14886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14886_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 186 - 388
Target Start/End: Original strand, 49198921 - 49199123
Alignment:
| Q |
186 |
cacttgtcaaagtatggtatgttttctgagtacaaaaaatgataatgatatccaagtttctttgtattgctttaggactgaaaaacttcttgtgttgcct |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49198921 |
cacttgtcaaagtatggtatgttttctgagtacaaaaaatgataatgatatccaagtttctttgtattgctttaggactgaaaaacttcttgtgttgcct |
49199020 |
T |
 |
| Q |
286 |
atggatccatcatcagggttctataaaggcatgattattggttttggtattggatacatttcttccaccaaaacctataaagtggctttattgtatatac |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49199021 |
atggatccatcatcagggttctataaaggcatgattattggttttggtattggatacatttcttccaccaaaacctataaagtggctttattgtatatac |
49199120 |
T |
 |
| Q |
386 |
cag |
388 |
Q |
| |
|
||| |
|
|
| T |
49199121 |
cag |
49199123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University