View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14886_high_3 (Length: 276)
Name: NF14886_high_3
Description: NF14886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14886_high_3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 7 - 276
Target Start/End: Original strand, 28987831 - 28988100
Alignment:
| Q |
7 |
ataacgattgtaaattggttcattctaatgctaattatggtgagaacatgttttggggaaagaagttgcattggacaccttctgatgcggtttattattg |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28987831 |
ataacgattgtaaattggttcattctactgctaattatggtgagaacatgttttggggaaagaagttgcattggacaccttctgatgcggtttattattg |
28987930 |
T |
 |
| Q |
107 |
gtacaaggagaagacttggtatagtttcaaaacccttaagtgtgagcctccaccaaagatgtgtgagcattttacgcagattgtgtggagggattcgacg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28987931 |
gtacaaggagaagacttggtatagtttcgaaacccttaagtgtgagcctccaccaaagatgtgtgagcattttacgcagattgtgtggagggattcgacg |
28988030 |
T |
 |
| Q |
207 |
catgttggatgtgccttgcagcattgcaagaacaacggtactggcatgctcatcgcgttcgagtataatc |
276 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28988031 |
catgttggatgtgccttgcaacattgcaagaacaacggtactggcatgctcatcgcgtgcgagtataatc |
28988100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University