View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14886_high_5 (Length: 241)
Name: NF14886_high_5
Description: NF14886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14886_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 229
Target Start/End: Complemental strand, 23419923 - 23419708
Alignment:
| Q |
16 |
agattgtggttaagtagcgcgtaagtggcggaactttggatagtttttgaaggtttgaatttggctggtttccttaagatcgagcttcattttgagttgc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23419923 |
agattgtggttaagtagcgcgtaagtggcggaactttggatagtttttgaaggtttgaatttggctggtttccataagatcgagcttcattttgagttgc |
23419824 |
T |
|
| Q |
116 |
tagtggttctacgctttcagctagtaaatgagggatg--gtggcaggtcggagtatagtgcaaaacattagacattaaatggagcgggattgggaagttc |
213 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23419823 |
tagtggttctacgctttcggctagtaaatgagggacggtgtggcaggtcggagtatagtgcaaaacattagacattaaatggagcaggattgggaagttc |
23419724 |
T |
|
| Q |
214 |
taagtacaatattctt |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23419723 |
taagtacaatattctt |
23419708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 31 - 206
Target Start/End: Original strand, 23883401 - 23883579
Alignment:
| Q |
31 |
agcgcgtaagtggcggaactttggatagtttttgaaggtttgaatttggctggtttccttaagatcgagcttcattttgagttgc---tagtggttctac |
127 |
Q |
| |
|
|||||||| ||||| ||||||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||| | | || |||||||| ||| |
|
|
| T |
23883401 |
agcgcgtatgtggcagaactttggatagattttgaaggtttgaatttggctagtttccataagatcgagcttcattttcactcgcaagtagtggttttac |
23883500 |
T |
|
| Q |
128 |
gctttcagctagtaaatgagggatggtggcaggtcggagtatagtgcaaaacattagacattaaatggagcgggattgg |
206 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| |||||||||||||||||| ||||||||| || || |||||||| |
|
|
| T |
23883501 |
gctttcagatagtaaatgagggactgtggcaggtaagagtatagtgcaaaacatcagacattaagtgaagtgggattgg |
23883579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 81
Target Start/End: Complemental strand, 23422051 - 23421999
Alignment:
| Q |
29 |
gtagcgcgtaagtggcggaactttggatagtttttgaaggtttgaatttggct |
81 |
Q |
| |
|
|||| ||||| ||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
23422051 |
gtagtgcgtatgtggcggaacttttgggaatttttgaaggtttgaatttggct |
23421999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 81
Target Start/End: Original strand, 23877003 - 23877055
Alignment:
| Q |
29 |
gtagcgcgtaagtggcggaactttggatagtttttgaaggtttgaatttggct |
81 |
Q |
| |
|
||||| |||| ||||||||||||| | ||||||||||||||| ||||||||| |
|
|
| T |
23877003 |
gtagcacgtatgtggcggaacttttgggagtttttgaaggttttaatttggct |
23877055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University