View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14886_high_7 (Length: 207)
Name: NF14886_high_7
Description: NF14886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14886_high_7 |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
| [»] scaffold0320 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 120
Target Start/End: Original strand, 6916780 - 6916882
Alignment:
| Q |
18 |
gtgtcaatgtcaatctttgaagcacacatactcctcgaattatgtgtatcccgatgtcagatatgtattgtgtccaacactgaattgacatcaacacata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
6916780 |
gtgtcaatgtcaatctttgaagcacacatactcctcgaattatgtgtatcccgatgtcagatatgtattgtgtccaacaccgacttgacatcaacacata |
6916879 |
T |
 |
| Q |
118 |
tga |
120 |
Q |
| |
|
||| |
|
|
| T |
6916880 |
tga |
6916882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 170
Target Start/End: Original strand, 663897 - 663957
Alignment:
| Q |
110 |
aacacatatgattacattaaaatatgccatttactcaaattattatcggtgtctacatgtc |
170 |
Q |
| |
|
||||||| || ||||||| ||||||||||| | |||||||||| ||| ||||| ||||||| |
|
|
| T |
663897 |
aacacatgtggttacattgaaatatgccatgttctcaaattatcatcagtgtcaacatgtc |
663957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 111 - 170
Target Start/End: Original strand, 38134414 - 38134473
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatcggtgtctacatgtc |
170 |
Q |
| |
|
||||||||||||||||| || |||| ||||| |||||||||||||||||||| ||||||| |
|
|
| T |
38134414 |
acacatatgattacattgaattatgtcattttctcaaattattatcggtgtcaacatgtc |
38134473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 109 - 155
Target Start/End: Original strand, 36314633 - 36314679
Alignment:
| Q |
109 |
caacacatatgattacattaaaatatgccatttactcaaattattat |
155 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
36314633 |
caacacatatgattacattgaaatatgtcattttctcaaattattat |
36314679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 111 - 162
Target Start/End: Original strand, 2525852 - 2525903
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatcggtgtc |
162 |
Q |
| |
|
||||||||||||| ||| || |||| ||||| |||||||||||||||||||| |
|
|
| T |
2525852 |
acacatatgattatattgaattatgtcatttgctcaaattattatcggtgtc |
2525903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 111 - 156
Target Start/End: Original strand, 20427643 - 20427688
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatc |
156 |
Q |
| |
|
||||||||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
20427643 |
acacatatgattacatttaaatatgtcatcttctcaaattattatc |
20427688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 109 - 184
Target Start/End: Original strand, 38749569 - 38749644
Alignment:
| Q |
109 |
caacacatatgattacattaaaatatgccatttactcaaattattatcggtgtctacatgtctgtgttagtgcttc |
184 |
Q |
| |
|
|||||||||| |||||||| || |||| ||||| ||||||||||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
38749569 |
caacacatataattacattgaattatgtcattttttcaaattattatcggtgtcgacatgtccgtgtttgtgcttc |
38749644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 28296386 - 28296328
Alignment:
| Q |
104 |
gacatcaacacatatgattacattaaaatatgccatttactcaaattattatcggtgtc |
162 |
Q |
| |
|
|||| |||||||||||| |||||| || |||| ||||| |||||||||||||||||||| |
|
|
| T |
28296386 |
gacaccaacacatatgagtacattgaattatgtcattttctcaaattattatcggtgtc |
28296328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 113 - 162
Target Start/End: Original strand, 2577190 - 2577239
Alignment:
| Q |
113 |
acatatgattacattaaaatatgccatttactcaaattattatcggtgtc |
162 |
Q |
| |
|
||||||||||||| |||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
2577190 |
acatatgattacactaaattatgtcattttctcaaattattatcggtgtc |
2577239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 162
Target Start/End: Complemental strand, 42469267 - 42469221
Alignment:
| Q |
116 |
tatgattacattaaaatatgccatttactcaaattattatcggtgtc |
162 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
42469267 |
tatgattacactaaaatatgtcattttctcaaattattatccgtgtc |
42469221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 111 - 163
Target Start/End: Original strand, 18513249 - 18513301
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatcggtgtct |
163 |
Q |
| |
|
||||||||||||||||| || |||| ||||| ||||||||||||||||||||| |
|
|
| T |
18513249 |
acacatatgattacattgaattatgtcattttctcaaattattatcggtgtct |
18513301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 174
Target Start/End: Original strand, 5654599 - 5654662
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatcggtgtctacatgtctgtg |
174 |
Q |
| |
|
|||| |||||||||||| || |||| ||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
5654599 |
acacgtatgattacattgaattatgtcattttctcaaattattatcagtgtcgacatgtctgtg |
5654662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 116 - 175
Target Start/End: Complemental strand, 10546194 - 10546135
Alignment:
| Q |
116 |
tatgattacattaaaatatgccatttactcaaattattatcggtgtctacatgtctgtgt |
175 |
Q |
| |
|
|||||||||||| || |||| ||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
10546194 |
tatgattacattgaattatgtcattttctcaaattattatcattgtcgacatgtctgtgt |
10546135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 111 - 162
Target Start/End: Original strand, 14465302 - 14465353
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatcggtgtc |
162 |
Q |
| |
|
||||||||||||| ||| || |||| ||||| |||||||||||||||||||| |
|
|
| T |
14465302 |
acacatatgattaaattgaattatgtcattttctcaaattattatcggtgtc |
14465353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 111 - 162
Target Start/End: Complemental strand, 56049927 - 56049877
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatcggtgtc |
162 |
Q |
| |
|
||||||||||||||||| || |||| ||||| |||||||||||||||||||| |
|
|
| T |
56049927 |
acacatatgattacattgaactatgtcattt-ctcaaattattatcggtgtc |
56049877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 184
Target Start/End: Complemental strand, 10164507 - 10164441
Alignment:
| Q |
118 |
tgattacattaaaatatgccatttactcaaattattatcggtgtctacatgtctgtgttagtgcttc |
184 |
Q |
| |
|
|||||||||| || |||||||||| || |||||| || |||||| ||||||| ||||||||||||| |
|
|
| T |
10164507 |
tgattacattcaattatgccattttcttaaattactaccggtgttgacatgtcagtgttagtgcttc |
10164441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 158
Target Start/End: Complemental strand, 20119997 - 20119949
Alignment:
| Q |
110 |
aacacatatgattacattaaaatatgccatttactcaaattattatcgg |
158 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
20119997 |
aacacatgtgattacattaaattatttcattttctcaaattattatcgg |
20119949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 111 - 161
Target Start/End: Complemental strand, 18571023 - 18570973
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatcggtgt |
161 |
Q |
| |
|
||||||||||||||||| || |||| ||||| ||||||||||||||||||| |
|
|
| T |
18571023 |
acacatatgattacattgaattatgtcattttctcaaattattatcggtgt |
18570973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 29970550 - 29970608
Alignment:
| Q |
104 |
gacatcaacacatatgattacattaaaatatgccatttactcaaattattatcggtgtc |
162 |
Q |
| |
|
|||||| ||||||||||||||| | || ||||| |||| |||||||||||| ||||||| |
|
|
| T |
29970550 |
gacatcgacacatatgattacactgaactatgcgattttctcaaattattagcggtgtc |
29970608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 104 - 175
Target Start/End: Complemental strand, 99951 - 99880
Alignment:
| Q |
104 |
gacatcaacacatatgattacattaaaatatgccatttactcaaattattatcggtgtctacatgtctgtgt |
175 |
Q |
| |
|
|||| |||||||||| |||||||| || |||| |||| || ||||||||||||||||| ||||||| |||| |
|
|
| T |
99951 |
gacaccaacacatataattacattgaattatgttattttctaaaattattatcggtgtcgacatgtccgtgt |
99880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 163
Target Start/End: Original strand, 42004953 - 42005007
Alignment:
| Q |
109 |
caacacatatgattacattaaaatatgccatttactcaaattattatcggtgtct |
163 |
Q |
| |
|
|||||| |||||||||| |||| |||| ||||| |||||||||||||| |||||| |
|
|
| T |
42004953 |
caacacctatgattacactaaattatgtcattttctcaaattattatccgtgtct |
42005007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 111 - 156
Target Start/End: Original strand, 35431148 - 35431193
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatc |
156 |
Q |
| |
|
|||| |||||||||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
35431148 |
acacctatgattacactaaaatatgtcattttctcaaattattatc |
35431193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 20691370 - 20691305
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatcggtgtctacatgtctgtgtt |
176 |
Q |
| |
|
||||||||||||||| | || |||| ||||| |||||||||||||| || ||||| |||| ||||| |
|
|
| T |
20691370 |
acacatatgattacactgaattatgtcattttctcaaattattatcagtttctacgtgtcagtgtt |
20691305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 187
Target Start/End: Complemental strand, 13799555 - 13799479
Alignment:
| Q |
111 |
acacatatgattacattaaaatatgccatttactcaaattattatcggtgtctacatgtctgtgttagtgcttcgta |
187 |
Q |
| |
|
|||||||| |||||| | || |||| ||||| |||||| ||||||||||||| || ||||||| | |||||||||| |
|
|
| T |
13799555 |
acacatattattacacttaattatgtcattttctcaaactattatcggtgtcaacgtgtctgtatctgtgcttcgta |
13799479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0320 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0320
Description:
Target: scaffold0320; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 109 - 161
Target Start/End: Original strand, 17042 - 17094
Alignment:
| Q |
109 |
caacacatatgattacattaaaatatgccatttactcaaattattatcggtgt |
161 |
Q |
| |
|
|||||||||| |||||||| | |||||||||| |||||||||||| |||||| |
|
|
| T |
17042 |
caacacatataattacattgatttatgccattttctcaaattattaacggtgt |
17094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University