View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14887_low_4 (Length: 250)
Name: NF14887_low_4
Description: NF14887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14887_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 232
Target Start/End: Original strand, 28900015 - 28900231
Alignment:
| Q |
17 |
attaaaggttctgatgcaaaactaaagtcaaaa-atgcctagaagatgttgatattattgcactcctcattgtttcccataaaaggttcagaaaaaatta |
115 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28900015 |
attaaaggttctgatacaaaactaaagtaaaaaaatgcctagaagatgttgatattattgcactcctcattgtttcccataaaaggttcagaaaaaatta |
28900114 |
T |
 |
| Q |
116 |
atgcctagagttttatgtagccataaatatatagtatgcttctgtttctcaagacgttgttgatattattgctcctcattgcttctcccctgtgatttac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28900115 |
atgcctagagttttatgtagccataaatatatagtatgcttctgtttctcaagaagttgttgatattattgctcctcattgcttctcccctgtgatttac |
28900214 |
T |
 |
| Q |
216 |
attgtatcccatgtgac |
232 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28900215 |
attgtatcccatgtgac |
28900231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 182 - 233
Target Start/End: Original strand, 28889972 - 28890023
Alignment:
| Q |
182 |
tattgctcctcattgcttctcccctgtgatttacattgtatcccatgtgact |
233 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28889972 |
tattgctcctcattgtttctcccctgtgatttacattgtatctcatgtgact |
28890023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 139 - 232
Target Start/End: Original strand, 28914572 - 28914665
Alignment:
| Q |
139 |
taaatatatagtatgcttctgtttctcaagacgttgttgatattattgctcctcattgcttctcccctgtgatttacattgtatcccatgtgac |
232 |
Q |
| |
|
||||| |||||||||||| |||||||||| | ||||| ||||| ||||| |||||||||||||| ||||| ||| || | ||||| |||||| |
|
|
| T |
28914572 |
taaatctatagtatgcttatgtttctcaatcggctgttggtattaatgctcatcattgcttctcccatgtgaattaaatcgcatcccgtgtgac |
28914665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 147 - 188
Target Start/End: Original strand, 28932700 - 28932741
Alignment:
| Q |
147 |
tagtatgcttctgtttctcaagacgttgttgatattattgct |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
28932700 |
tagtatgcttctgtttctcaagaagttgttggtattattgct |
28932741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 194 - 228
Target Start/End: Original strand, 28923854 - 28923888
Alignment:
| Q |
194 |
ttgcttctcccctgtgatttacattgtatcccatg |
228 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
28923854 |
ttgcttctcccctgtgatttacatcgtatcccatg |
28923888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University