View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14888_high_2 (Length: 297)
Name: NF14888_high_2
Description: NF14888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14888_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 42 - 279
Target Start/End: Original strand, 9411866 - 9412093
Alignment:
| Q |
42 |
aaaactcataagccaaaatccagtatctatatctatctcagtaccctacaccctagaaccatatccattaccatttgttccattcaatacttgcaacttg |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
9411866 |
aaaactcataagccaaaatccagtatctatatctatctcagtatcctacaccctagaaccatatccattaccatttgttccattcattccttgcaacttg |
9411965 |
T |
 |
| Q |
142 |
ttctctgatttcttcctcttgatcacaatgtcaatgatccatgtgtaagcttccaaaagtacagcaattaatgccacccaatgctgcaataatgccggtg |
241 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||| |
|
|
| T |
9411966 |
ttctctgatttcttcctcttgatca------caatgatccatgtgtaagcttccaaaagtacagc----aacaccacccaatgctgcgataatgccggtg |
9412055 |
T |
 |
| Q |
242 |
tatgcatgcttccagttatcgtagcgatctgctgcaga |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9412056 |
tatgcatgcttccagttatcgtagcgatctgctgcaga |
9412093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University