View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14888_high_5 (Length: 207)
Name: NF14888_high_5
Description: NF14888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14888_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 11 - 189
Target Start/End: Original strand, 25296111 - 25296289
Alignment:
| Q |
11 |
atcatcatcatcttcttctgcattgtggccaactcaggcccatgatcttccccaccacggtgcattgccaaatgtggcaaatgcatcccatgcatagcaa |
110 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296111 |
atcatcttcttcttcttctgcattgtggccaactcaggcccatgatcttccccaccacggtgcattgccaaatgtggcaaatgcatcccatgcatagcaa |
25296210 |
T |
 |
| Q |
111 |
tggtggggaatgttggaatttcagccgggaatttccctcaagcctggaggtgcttttgcggagggaaattctacaatcc |
189 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296211 |
tggtggggaatgttggaatttcagtcgggtatttccctcaagcctggaggtgcttttgcggagggaaattctacaatcc |
25296289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University