View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14888_low_3 (Length: 265)
Name: NF14888_low_3
Description: NF14888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14888_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 76 - 233
Target Start/End: Complemental strand, 39045844 - 39045687
Alignment:
| Q |
76 |
gttgatattaaatcgaatcaaattgattcttcaacatacatataccataccatctcgtactgttttggcataacccgtgatacactgaccgttaactatt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39045844 |
gttgatattaaatcgaatcaaattgattcttcaacatacatataccataccatctcgtactgttttggcataacccttgatacactgaccgttaactatt |
39045745 |
T |
 |
| Q |
176 |
atccaaccatctttgacttggcgcattcacaacactttggttttttctttccctctcc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39045744 |
atccaaccatctttgacttggcgcattcacaacactttggttttttctttccctctcc |
39045687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University