View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14888_low_7 (Length: 201)
Name: NF14888_low_7
Description: NF14888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14888_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 184
Target Start/End: Original strand, 31166857 - 31167024
Alignment:
| Q |
17 |
gtggatggagatgttgtaaggtccagcatttgttactttgatcaccatagaatctccgtctcttgctacgattgttgggccaggaaactgtccatttacc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||| ||||||||||||||||||||| |
|
|
| T |
31166857 |
gtggatggagatgttgtaaggtccagcatttgttactttgatcaccatagaatctccgtctctagcttcgatcgttggaccaggaaactgtccatttacc |
31166956 |
T |
 |
| Q |
117 |
gtgagtatccttcgagttttgcacagcctcttcactgttgcagtttgaatctatttccatcaaccatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31166957 |
gtgagtatccttcgagttttgcacagcctcttcactgttgcagtttgaatctatttccatcaaccatt |
31167024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University