View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14889_low_13 (Length: 217)
Name: NF14889_low_13
Description: NF14889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14889_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 43519402 - 43519606
Alignment:
| Q |
1 |
tagtaaaaataacaaaggtcttgctaacaagtgtgtgcgctcgggacacttgtgcttctctaagggtctcaccccattcactaccc-gtgacttctttac |
99 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
43519402 |
tagtaaaaataacagaggtcttgctaacaagtgtgtgcgctcgggacacttgtgcttctctaagggtctcaccccattcactaccccgtgatttctttac |
43519501 |
T |
 |
| Q |
100 |
tcaccaatacttgatactatcatgtgcaacaccataaccaaccacaataatagcatgttggttatgtttcacgtttgtgattgtattccgtgtgaacaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43519502 |
tcaccaatacttgatactatcatgtgcaacaccataaccaaccacaataatagcatgttggttatgtttcacgtttgtgattgtattccgtgtgaacaaa |
43519601 |
T |
 |
| Q |
200 |
ggtga |
204 |
Q |
| |
|
||||| |
|
|
| T |
43519602 |
ggtga |
43519606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University