View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14890_high_3 (Length: 214)

Name: NF14890_high_3
Description: NF14890
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14890_high_3
NF14890_high_3
[»] chr8 (1 HSPs)
chr8 (4-214)||(12529212-12529415)


Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 4 - 214
Target Start/End: Original strand, 12529212 - 12529415
Alignment:
4 gaacttcagcaacagaagcaccgaacaatgacaacagcaggatccgaggaagatagagcaatcttgggtcagaatagtggacatgcaccac-aacatagg 102  Q
    ||||||||| ||||| || ||| |||||| |||||||| |||||| |||||||||||| |||| ||||||||||||||||||||||||||| ||||||||    
12529212 gaacttcagtaacagcagaaccaaacaataacaacagccggatccaaggaagatagagtaatcctgggtcagaatagtggacatgcaccacaaacatagg 12529311  T
103 tggacagttccggtgagaggcgaagttaagtgtaacgtggatgcaccaatcttcaacgacaaaaattgtttttagtgctgctatgtgtgttagaaacgaa 202  Q
    ||||||||||||||||||||||||||||||||||||| |||||       |||||||||||||||||| |||||||||||||||||||| ||||||||||    
12529312 tggacagttccggtgagaggcgaagttaagtgtaacgaggatg-------cttcaacgacaaaaattg-ttttagtgctgctatgtgtgatagaaacgaa 12529403  T
203 agaggtgaattc 214  Q
    ||||||||||||    
12529404 agaggtgaattc 12529415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University